bcgRNA Amplification Protocol (v1.0 03-01-2023)


Required reagents (not included in starter kit):
	Invitrogen DynaMag-2 Magnet (Fisher Scientific #12321D)
	KAPA HiFi HotStart ReadyMix (Roche #7958935001)
	1.5 mL DNA LoBind tubes (Common lab suppliers)
	8-strip PCR tubes, emulsion safe! (e.g. TempAssure PCR 8-strips, USA Scientific #1402-4700)
	SPRIselect reagent (GE Healthcare #B23317)
	

This protocol includes all information needed to amplify the bcgRNA library as part of a 10x Genomics 3' V3 scRNA-seq kit with Feature Barcoding.
For reference, please visit: https://www.10xgenomics.com/support/single-cell-gene-expression/documentation/steps/library-prep/chromium-single-cell-3-reagent-kits-user-guide-v-3-1-chemistry-with-feature-barcoding-technology-for-crispr-screening


Tips:
	a. Please follow recommendation of cite-seq.com for Hashing and CITE-seq protocols.
	b. CaRPool-seq may be performed at low MOI (~0.1) to ensure single viral integration (>95% single integration probability). Modified protocols and analysis may be used in high-MOI setting.
	c. CaRPool-seq may be performed 5-10 days post Cas13d induction in fully selected (puromycin) or sorted (GFP+) cells to avoid loss of cells expressing essential gene targeting gRNAs.

This protocol assumes, that cells have been prepared for a CaRPool-seq experiment including cell staining for Cell Hashing and CITE-seq.
Specifically:
a. Cells have been infected with guide RNA expressing pLentiRNAGuide_003 vectors.
b. Cells have been fully selected (puromycin), and GFP expression may be confirmed in all cells.
c. Cas13d expression has been induced with Doxycycline, if applicable (Addgene #138149).



Run 10x Genomics 3' V3 scRNA-seq kit with Feature Barcoding
	- Follow the instruction up to "Post GEM RT-Cleanup" (step 2.1).
	- Follow the Dynabead cleanup procedure and elute in 35 - x µl (see below).

At post-RT cleanup (step 2.1o to step 2.1s):
	- Elute in 34 µl if bcgRNA (and/or ADTs) will be captured
	- Elute in 33 µl if bcgRNA (and/or ATDs) and hashing HTOs will be captured

At cDNA amplification step (step 2.2):
	- Add “additive” primers to cDNA PCR to increase yield of bcgRNA (and HTO or ADT) products:
	- Add 1µl of 0.4µM bcgRNA additive primer 
	  (bcgRNA additive primer is the same as the ADT additive primer. 1µl will serve both bcgRNA and ADT amplification)
	- Add 1µl of 0.2µM HTO additive primer, if applicable.
	Subtract the additive primer volume from the Dynabead cleanup elution volume (see step above).

After cDNA amplification (step 2.3):
	- Follow the 10x Genomics user guide (step 2.3) with the following modifications and separate bcgRNA-derived cDNAs (<180bp, also ADT and HTO) and mRNA-derived cDNAs (>300bp) 
	- Add 60µl SPRIselect (0.6x) to the 100 cDNA reaction. Incubate 5 minutes and place on magnet.
	- Supernatant contains cDNAs from bcgRNAs, ADTs and hashes.
	- Beads contain full length mRNA-derived cDNAs.
	- Transfer and save 150-160 μl supernatant in a new tube strip without disturbing the pellet. Maintain at room temperature. DO NOT discard the transferred supernatant (cleanup for CRISPR Screening, ADT and Hashing library construction). 

	mRNA-derived cDNA >300bp (beads fraction).
		- Immediately proceed with 10x Genomics user guide for 3' Gene Expression library (step 2.3A).

	bcgRNA (ADT and HTO) cDNAs <180bp (supernatant fraction).
	- Purify using two 2X SPRI purifications:
		- Add 1.4X SPRI to supernatant to obtain a final SPRI volume of 2X SPRI.
		  For example: The cDNA PCR reaction volume is 100 μl, 60uL 
		  (0.6X) SPRI was added for capturing full length cDNAs, therefore add another 140 μl of SPRI to the supernatant. 
		  The final volume will be 300 μl containing 2X SPRI.
		- Transfer entire volume into a low-bind 1.5mL tube.
		- Incubate 10 minutes at room temperature.
		- Place tube on magnet and wait ~2 minutes until solution is clear.
		- Carefully remove and discard the supernatant.
		- Add 400 μl 80% Ethanol to the tube without disturbing the pellet and stand for 30
		  seconds (only one Ethanol wash).
		- Carefully remove and discard the ethanol wash.
		- Centrifuge tube briefly and return it to magnet.
		- Remove and discard any remaining ethanol.
		- Resuspend in beads in 50 μl water.
		- Perform another round of 2X SPRI purification by adding 100 μl SPRI reagent directly onto resuspended beads.
		  (This step ensures that no primers carry over. Residual primers can lead to unwanted primer-dimer ~140-160bp products.)
		- Mix by pipetting and incubate 10 minutes at room temperature.
		- Place tube on magnet and wait ~2 minutes until solution is clear.
		- Carefully remove and discard the supernatant.
		- Add 200 μl 80% Ethanol to the tube without disturbing the pellet and stand for 30
		  seconds (1st Ethanol wash).
		- Carefully remove and discard the ethanol wash.
		- Add 200 μl 80% Ethanol to the tube without disturbing the pellet and stand for 30
		  seconds (2nd Ethanol wash).
		- Carefully remove and discard the ethanol wash.
		- Centrifuge tube briefly and return it to magnet.
		- Remove and discard any remaining ethanol and allow the beads to air dry for 2
		  minutes (do not over dry beads).
		- Resuspend beads in Nx45 +1 µl water.
		  For example: If you perform CaRPool-seq with CITE-seq and Hashing, 
		  resuspend the beads in 3x45 + 1 µl H2O (136 µl) for bcgRNA, ADTs and HTO oligos.
		  Each PCR for each modality will require 45µl input volume. 
		- Pipette mix vigorously and incubate at room temperature for 5 minutes.
		- Place tube on magnet and transfer clear supernatant into PCR tube.

	(optional) Amplify ADT and HTO libraries:
	- follow protocols on cite-seq.com

	Amplify bcgRNA library:
	- Prepare 100 µl PCR reaction with purified bcgRNA cDNA (PCR1):
		- 45 μl purified bcgRNA cDNA fraction
		- 50 μl 2x KAPA Hifi PCR Master Mix
		- 2.5 μl Truseq Small RNA RPIx primer (containing i7 index) 10 μM
		- 2.5 μl Feature SI Primers 2 (PN-2000099) (10µM) (optional P5 indexing primer)
		- Cycling conditions:
			95°C	 3 min
			95°C	20 sec |
			60°C	 8 sec | 10-16 PCR cycles (recommended: step-wise optimization, see below)
			72°C	 8 sec |
			72°C	 1 min
			12°C	   inf
		- (Optional: Verify specific bcgRNA amplicon running 2 µl of the 100 µl PCR reaction on a 2% E-Gel. The expected amplicon is 192 bp. 
		  If needed, add more PCR cycles.)

	- Purify PCR product using 1.6X SPRI purification by adding 160 μl SPRI reagent:
		- Incubate 5 minutes at room temperature.
		- Place tube on magnet and wait 1 minute until solution is clear.
		- Carefully remove and discard the supernatant.
		- Add 200 μl 80% Ethanol to the tube without disturbing the pellet and stand for 30 seconds (first Ethanol wash).
		- Carefully remove and discard the ethanol wash.
		- Add 200 μl 80% Ethanol to the tube without disturbing the pellet and stand for 30
		  seconds (second Ethanol wash).
		- Carefully remove and discard the ethanol wash.
		- Centrifuge tube briefly and return it to magnet.
		- Remove any remaining ethanol and allow the beads to air dry for 2 minutes.
		- Resuspend beads in 21 μl water.
		- Pipette mix vigorously and incubate at room temperature for 5 minutes.
		- Place tube on magnet and transfer 20 µl cleared supernatant to a new PCR tube.

	- bcgRNAs are now ready to be sequenced:
	  However, it can be that additional by-products occured (< 180bp) or that significant full length cDNA carryover is present.
	  Both possibly scenarios will be addressed further below.
		- Quantify libraries by standard methods (QuBit, BioAnalyzer, TapeStation, KAPA library quantification). 
		- bcgRNA cDNA libraries will be around 192 bp.

	- (Optional) P5/P7 PCR (PCR2)
	  Prepare 100uL PCR reaction with purified bcgRNA PCR1 product:
		- 20 μl purified bcgRNA PCR1 product
		- 25 µl H2O
		- 50 μl 2x KAPA Hifi PCR Master Mix
		- 2.5 μl P5 primer (10 μM)
		- 2.5 μl P7 primer (10 μM)
		- Cycling conditions:
			95°C	 3 min
			95°C	20 sec |
			60°C	 8 sec | ~4 PCR cycles (recommended: step-wise optimization, see below)
			72°C	 8 sec |
			72°C	 1 min
			12°C	   inf
		- (Optional: Verify specific bcgRNA amplicon running 2 µl of the 100 µl PCR reaction on a 2% E-Gel. The expected amplicon is 192 bp. 
		  If needed, add more PCR cycles.)
		- Purify PCR product using 1.6X SPRI purification by adding 160 μl SPRI reagent (described above)

	Typically, we apply a total of ~26 PCR cycles:
		10 cycles of cDNA amplification (incl. additive primers), 
		12 cycles of bcgRNA cDNA PCR 1, 
		and 4 cycles of P5/P7 PCR2

	- (Optional) In case you observe significant full length cDNA carryover you can consider applying a double-sided SPRIselect cleanup (after PCR1 or PCR2):
	  This step will reduce the fraction of length cDNA fragments in the bcgRNA cDNA amplicon
	 	- Add 80 µl SPRI to 100µl of PCR reaction (0.8x SPRI) and mix by pipetting up and down 10 times without generating bubbles.
	 	- Incubate 5 minutes at room temperature.
	 	- Place tube on magnet and wait 1 minute until solution is clear.
	 	- Transfer the supernatant to a new tube
	 	  Long DNA fragments are bound to the beads. The beads can be discarded.
	 	  The short DNA fragments (including bcgRNA cDNA) are present in the supernatant.
	 	- Add another 80 µl SPRI to 160µl supernatant (0.8x + 0.8x = 1.6x SPRI) and mix by pipetting up and down 10 times
	 	- Incubate 5 minutes at room temperature.
		- Place tube on magnet and wait 1 minute until solution is clear.
		- Carefully remove and discard the supernatant.
		- Add 200 μl 80% Ethanol to the tube without disturbing the pellet and stand for 30 seconds (first Ethanol wash).
		- Carefully remove and discard the ethanol wash.
		- Add 200 μl 80% Ethanol to the tube without disturbing the pellet and stand for 30
		  seconds (second Ethanol wash).
		- Carefully remove and discard the ethanol wash.
		- Centrifuge tube briefly and return it to magnet.
		- Remove any remaining ethanol and allow the beads to air dry for 2 minutes.
		- Resuspend beads in 21 μl water.
		- Pipette mix vigorously and incubate at room temperature for 5 minutes.
		- Place tube on magnet and transfer 20 µl cleared supernatant to a new PCR tube.


	- Sequencing bcgRNA libraries:
	  bcgRNA (+ADT, +HTO) and cDNA sequencing libraries can be pooled at desired proportions and sequenced in parallel. 
	  We typically allocate ~50K reads per cell for the cDNA library as recommended by 10x Genomics.
	  For bcgRNA (and HTO) libraries we allocate ~1K reads per cell, expecting one feature per cell.
	  For ADT libraries we allocate ~2-5K reads per cell depending on the size of the antibody panel.
	  Read1: 28 cycles
	  Read2: 15 cycles for bcgRNA (if sequenced together with cDNA, Read2 will typically be longer.)
	  (we do not recommend sequencing the bcgRNA amplicon alone. Low complexity regions following cycle 16 on Read2 may lead to low quality reads.)


Primer sequences (5'-3'):
	bcgRNA (+ADT) additive primer
	CCTTGGCACCCGAGAATT*C*C (optional * Phosphorothioate bond)

	Feature SI Primers 2 (like in 10x Genomics PN-2000099)
	AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

	Illumina Small RNA RPI1 primer (for ADT amplification; i7 index 1, Oligonucleotide sequences © 2015 Illumina, Inc)
	CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA

	P5 primer
	AATGATACGGCGACCACCGA

	P7 primer
	CAAGCAGAAGACGGCATACGAGA